Review




Structured Review

Merck & Co custom dna oligo synthesis service
Custom Dna Oligo Synthesis Service, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+dna+oligo+synthesis+service/oligonucleotides/bio_rxiv__64898__2026__03__17__712295-223-8-14
Average 86 stars, based on 1 article reviews
custom dna oligo synthesis service - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Cloning:

Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition.
Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/ addgene:183411; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410; http://n2t.net/addgene:183410; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the custom DNA oligo synthesis service from Merck and are listed in the ‘‘Oligonucleotides’’ section of the key resources table. ..

Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition
Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/addgene:183411 ; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410 ; http://n2t.net/addgene:183410 ; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the custom DNA oligo synthesis service from Merck and are listed in the “Oligonucleotides” section of the Key resources table. ..

Oligo Synthesis:

Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition.
Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/ addgene:183411; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410; http://n2t.net/addgene:183410; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the custom DNA oligo synthesis service from Merck and are listed in the ‘‘Oligonucleotides’’ section of the key resources table. ..

Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition
Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/addgene:183411 ; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410 ; http://n2t.net/addgene:183410 ; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the custom DNA oligo synthesis service from Merck and are listed in the “Oligonucleotides” section of the Key resources table. ..

Article Title: Hierarchical TBX6-FOXC Regulatory Logic Controls Human Trunk Mesoderm Diversification
Article Snippet: The SOX2:mNeon iPSC line was generated with the following plasmids: pCAS9-mCherry-Frame +0 (gift from Veit Hornung, Addgene plasmid # 66939; http://n2t.net/addgene:66939 ; RRID:Addgene_66939), pCRISPaint-mNeon-PuroR [M1G] (gift from Michael Hoelzel, Addgene plasmid # 171800; http://n2t.net/addgene:171800 ; RRID:Addgene_171800), and pSPgRNA (gift from Charles Gersbach, Addgene plasmid # 47108; http://n2t.net/addgene:47108 ; RRID:Addgene_47108) containing gRNA targeting the human SOX2 locus (TGCCCCTCTCACACATGTGA). .. All gRNA oligos used were ordered using the custom DNA oligo synthesis service from Merck and are listed in the ‘‘Oligonucleotides’’ section of the key resources table. ..



Similar Products

99
Thermo Fisher custom dna oligos synthesis services
Custom Dna Oligos Synthesis Services, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+dna+oligo+synthesis+service/DNA/pm37369829-272-6-11
Average 99 stars, based on 1 article reviews
custom dna oligos synthesis services - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Merck & Co custom dna oligo synthesis service
Custom Dna Oligo Synthesis Service, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+dna+oligo+synthesis+service/oligonucleotides/bio_rxiv__64898__2026__03__17__712295-223-8-14
Average 86 stars, based on 1 article reviews
custom dna oligo synthesis service - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Macrogen custom dna oligo synthesis service
Custom Dna Oligo Synthesis Service, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+dna+oligo+synthesis+service/oligonucleotide+synthesis/bio_rxiv__2022__12__21__521502-30-10-16
Average 90 stars, based on 1 article reviews
custom dna oligo synthesis service - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results