custom dna oligo synthesis service (Merck & Co)
86
Structured Review
Merck & Co
custom dna oligo synthesis service
Custom Dna Oligo Synthesis Service, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+dna+oligo+synthesis+service/oligonucleotides/bio_rxiv__64898__2026__03__17__712295-223-8-14
Average 86 stars, based on 1 article reviews
Custom Dna Oligo Synthesis Service, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+dna+oligo+synthesis+service/oligonucleotides/bio_rxiv__64898__2026__03__17__712295-223-8-14
Average 86 stars, based on 1 article reviews
custom dna oligo synthesis service - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Cloning:Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition. Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/ addgene:183411; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410; http://n2t.net/addgene:183410; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/addgene:183411 ; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410 ; http://n2t.net/addgene:183410 ; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the Oligo Synthesis:Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition. Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/ addgene:183411; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410; http://n2t.net/addgene:183410; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the Article Title: Identification of a core transcriptional program driving the human renal mesenchymal-to-epithelial transition Article Snippet: pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411; http://n2t.net/addgene:183411 ; RRID:Addgene_183411). pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410 ; http://n2t.net/addgene:183410 ; RRID:Addgene_183410). .. All oligos used for cloning were ordered using the Article Title: Hierarchical TBX6-FOXC Regulatory Logic Controls Human Trunk Mesoderm Diversification Article Snippet: The SOX2:mNeon iPSC line was generated with the following plasmids: pCAS9-mCherry-Frame +0 (gift from Veit Hornung, Addgene plasmid # 66939; http://n2t.net/addgene:66939 ; RRID:Addgene_66939), pCRISPaint-mNeon-PuroR [M1G] (gift from Michael Hoelzel, Addgene plasmid # 171800; http://n2t.net/addgene:171800 ; RRID:Addgene_171800), and pSPgRNA (gift from Charles Gersbach, Addgene plasmid # 47108; http://n2t.net/addgene:47108 ; RRID:Addgene_47108) containing gRNA targeting the human SOX2 locus (TGCCCCTCTCACACATGTGA). .. All gRNA oligos used were ordered using the |